Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Our results provide a first description of

    2020-08-18


    Our results provide a first description of the functional effects of the combination of Axl inhibition and miR-137 increase in NSCLC. Importantly, the ability of the AmiC to affect patient-derived 863918-78-9 and interfere with tumor growth in xenograft mouse models revealed favorable prospects for a further in vivo development of the molecule. In addition, the use of chemically modified nucleotides enhances the safety of the AmiC, minimizing the potential of non-specific immu-nostimulatory effects16 and enhancing serum stability.18
    In conclusion, our data demonstrate a broad applicability of the miR-137 AmiC in cancer therapy, indicating that it has the potential to target Axl-expressing cancer cells interfering with multiple processes and may be developed for NSCLC treatment.
    MATERIALS AND METHODS
    Cell Culture and Transfection
    Cell lines were purchased from the ATCC (LG Standards, Milan, Italy). Human NSCLC A549 (Axl+) were grown in RPMI medium 
    supplemented with 10% fetal bovine serum (FBS); human breast MCF-7 (Axl ) cells were grown in DMEM supplemented with 10% FBS.
    To prepare primary cell cultures, human lung biopsies (samples from Azienda Ospedaliera Universitaria Primo Policlinico, Naples, Italy) were cut mechanically. Isolated cells were grown in DMEM/nutrient F12-Ham (DMEM-F12) supplemented with 10% FBS. All cell culture reagents were purchased from Sigma (St. Louis, MO, USA).
    Transfections were performed using serum-free Opti-MEM and Lipofectamine 2000 reagent (Thermo Fisher Scientific, Waltham, MA, USA). In brief, cells were seeded in 6-well plates (1.4 105 cells/well) or in 96-well plates (3 103 cells/well), and transfections were performed in the presence of 3 mL or 0.2 mL Lipofectamine 2000, respectively. Cells were transfected with 100 nmol/L of pre-miR miR precursor miR-137 (miR-137) and negative control #1 (ctrl-miR) (Thermo Fisher Scientific, Waltham, MA, USA).
    Aptamer-miR Complexes
    GL21.T: 50-AUGAUCAAUCGCCUCAAUUCGACAGGAGGC UCAC-30;
    Control aptamer (CtrlApt): 50-GCACGCAAAUAGCGACUUC AGACGACUCUUCAGU-30;
    GL21.T stick: 50-AUGAUCAAUCGCCUCAAUUCGACAGG AGGCUCACXXXXGUACAUUCUAGAUAGCC-30;
    Control aptamer stick: 50-GCACGCAAAUAGCGACUUCAG ACGACUCUUCAGUXXXXGUACAUUCUAGAUAGCC-30; miR-137 passenger stick: 50-GGUGACGGGUAUUCUUGGG UGGAUAAUAGGCUAUCUAGAAUGUAC-30;
    RNA sequences were synthesized 863918-78-9 by DNA/RNA Synthesis Laboratory at the Beckman Research Institute of City of the Hope (Duarte, CA, USA) or Tebu-bio srl (Magenta, Milan, Italy) and contained 20F-Py. Stick sequences (underlined) consist of 20F-Py and 20-oxygen-methyl
    www.moleculartherapy.org
    A
    B
    and In Vivo
    (A–D) NSCLC patient derived cells (#17 and #18, Axl+) cells were treated with 400 nmol/L of GL21.T, Ctrl Apt, CtrlApt-137, or GL21.T-137. (A and B) Cell migration of NSCLC patient cells #17 (A) or #18 (B) was analyzed by transwell migration assay. Migrated cells were stained with crystal violet and photographed. Left panels: repre-sentative micrographs are shown. Right panels: migrated cells were quantified and expressed as percent of migrated cells with respect to untreated cells ( ). (C and
    D) Following 72 h of treatments, cell viability of NSCLC patient cells #17 (C) or #18 (D) was measured by MTT assay and expressed as percentage of viable cells relative
    Cell Binding and Internalization Assay by qRT-PCR
    Cells (2 105 cells/well in 6-well plate) were treated with 200 nmol/L of GL21.T-137 at 37 C in the presence of 100 mg/mL polyinosine used as a non-specific competitor (Sigma) as indicated and washed three times with PBS (for binding). For internalization, cells were washed three times with 0.5 M NaCl PBS22 or treated with 0.5 mg/mL
    cell-surface-bound RNA. RNA was recovered by TRIzol (Life Technologies) containing 0.5 pmol/mL of CL4 aptamer (CL4, 50-GCCUUAG UAACGUGCUUUGAUGUCGAUUCGACAG GAGGC-30), used as a reference control. The amount of bound RNAs was determined by per-forming qRT-PCR, as previously reported17 by
    using the following primers: GL21.T (forward), 50-AGATCATGAT CAATCGCC-30; GL21.T (reverse), 50-GTGAGCCTCCTGTCGA-30; CL4 (forward), 50-GCCTTAGTAACGTGCTTT-30; and CL4 (reverse) 50-GCCTCCTGTCGAATCG-30. The amounts of RNA was calculated relative to a standard curve of known RNA input and normalized to the CL4 reference control. The percent of internalization was ex-pressed as the amount of internalized aptamer relative to total bound aptamer.
    miR Level Analyses by qRT-PCR
    To assess miR levels, RNAs were extracted with TRiZol (Thermo Fisher Scientific, Waltham, MA, USA) and 500 ng of total RNA
    was reverse transcribed with miScript reverse transcription kit (QIAGEN, Milan, Italy) according to the manufacturer’s proto-col. Amplification was performed by using the miScript-SYBR green PCR kit and miScript primer assay specific for miR-137-3p (QIAGEN, Milan, Italy). U6 RNA was used as a housekeeping control gene.